Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 4810885 4816835 enh16945
chr17 4811647 4812042 vista23810

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 4811545 rs7209905 C G 4716619
chr17 4811615 rs7214776 T C 4716620
chr17 4811632 rs149914565 A T 4716621
chr17 4811749 rs532091492 TGCTGGGAGCAAAGCTCAGCCACCGTTCCTGCCAGC T 4716622
chr17 4811749 rs58493373 T C 4716623
chr17 4811796 rs148624390 C A,T 4716624
chr17 4811917 rs145612832 G A,C 4716625

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results