Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 8031830 8031985 vista23895

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 8031216 rs371854936 C T 4733016
chr17 8031259 rs111996269 T C 4733017
chr17 8031270 rs541387781 A C 4733018
chr17 8031290 rs553397616 C T 4733019
chr17 8031317 rs201970408 AC A 4733020
chr17 8031318 rs4586512 C T 4733021
chr17 8031372 rs187426160 G T 4733022
chr17 8031456 rs11869210 C A 4733023
chr17 8031539 rs547130946 A G 4733024
chr17 8031559 rs192844785 G A 4733025
chr17 8031639 rs549834953 T TAGATAGATAGATAGATGGATAG 4733026
chr17 8031640 rs569866206 A G 4733027
chr17 8031656 rs537208127 A G 4733028
chr17 8031657 rs558473563 G T 4733029
chr17 8031658 rs570704115 A C,G 4733030

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results