Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 8031830 8031985 vista23895

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 8031639 rs549834953 T TAGATAGATAGATAGATGGATAG 4733026
chr17 8031640 rs569866206 A G 4733027
chr17 8031656 rs537208127 A G 4733028
chr17 8031657 rs558473563 G T 4733029
chr17 8031658 rs570704115 A C,G 4733030
chr17 8031845 rs143889237 A G 4733031
chr17 8031852 rs557593153 G A 4733032
chr17 8031936 rs8067165 C G 4733033
chr17 8031955 rs56067341 A T 4733034
chr17 8032068 rs9889775 G T 4733035
chr17 8032085 rs56136016 C T 4733036
chr17 8032132 rs181267249 G T 4733037
chr17 8032133 rs547884189 T G 4733038
chr17 8032227 rs530708960 C T 4733039
chr17 8032228 rs376796385 C G 4733040
chr17 8032282 rs7215316 T C 4733041

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results