EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:47081357-47081747]
Chromosome characteristics of ZNF274[chr17:47081357-47081747]
Back to top
Enhancers possibly regulated by ZNF274[chr17:47081357-47081747]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 47080625 47087635 enh92734
Liver (HepG2)
chr17 47081384 47081547 vista25053
VISTA
SNP sites on ZNF274[chr17:47081357-47081747]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 47081416 rs188977591 C G,T 4912969
chr17 47081456 rs528855742 C G 4912970
chr17 47081625 rs537961500 G A 4912971
chr17 47081648 rs570752414 A ACGAGAGGGTTCCCCCTCAC 4912972
chr17 47081668 rs527695012 C T 4912973
Genes possibly regulated by ZNF274[chr17:47081357-47081747]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:47081357-47081747]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results