EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:47113221-47114081]
Chromosome characteristics of ZNF274[chr17:47113221-47114081]
Back to top
Enhancers possibly regulated by ZNF274[chr17:47113221-47114081]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 47113510 47113580 vista25057
VISTA
SNP sites on ZNF274[chr17:47113221-47114081]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 47113239 rs533696334 C T 4913248
chr17 47113262 rs375477811 G A 4913249
chr17 47113314 rs57094030 C A 4913250
chr17 47113412 rs8082366 A G 4913251
chr17 47113440 rs139927911 GCGGGGTTGACTGGAAGCGAC G 4913252
chr17 47113440 rs375184101 GCGGGGTTGACTGGAAGCGAC G 4913253
chr17 47113483 rs189273971 G T 4913254
chr17 47113838 rs201324605 T TA 4913255
chr17 47113987 rs552077100 A G 4913256
chr17 47114031 rs375942685 G T 4913257
chr17 47114033 rs11870560 T C 4913258
chr17 47114077 rs561300338 C T 4913259
Genes possibly regulated by ZNF274[chr17:47113221-47114081]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:47113221-47114081]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results