Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 47113510 47113580 vista25057

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 47113412 rs8082366 A G 4913251
chr17 47113440 rs139927911 GCGGGGTTGACTGGAAGCGAC G 4913252
chr17 47113440 rs375184101 GCGGGGTTGACTGGAAGCGAC G 4913253
chr17 47113483 rs189273971 G T 4913254

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results