EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr17:58222975-58223231]
Chromosome characteristics of ZNF143[chr17:58222975-58223231]
Back to top
Enhancers possibly regulated by ZNF143[chr17:58222975-58223231]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 58222591 58223049 vista25381
VISTA
SNP sites on ZNF143[chr17:58222975-58223231]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 58223106 rs538518378 A AGACAGCGGAGAATCTGCGG 4963340
chr17 58223108 rs114858353 T A 4963341
chr17 58223135 rs77769633 G A 4963342
Genes possibly regulated by ZNF143[chr17:58222975-58223231]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 58227297 58248260 + CA4 ENSG00000167434.5 58227297 0.87 1.0 4066 16112
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF143[chr17:58222975-58223231]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results