EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:60445147-60445962]
Chromosome characteristics of ZNF274[chr17:60445147-60445962]
Back to top
Enhancers possibly regulated by ZNF274[chr17:60445147-60445962]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 60444796 60445181 vista25432
VISTA
SNP sites on ZNF274[chr17:60445147-60445962]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 60445172 rs147198873 G A 4972678
chr17 60445260 rs539545401 G A 4972679
chr17 60445356 rs76706018 G A 4972680
chr17 60445387 rs187166062 A G 4972681
chr17 60445515 rs60952285 A G 4972682
chr17 60445781 rs114102261 C T 4972683
chr17 60445832 rs574474144 TATCCAAGTGCCTGGCACCTAGA T 4972684
chr17 60445947 rs16946001 A G 4972685
Genes possibly regulated by ZNF274[chr17:60445147-60445962]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 60447579 60493837 + EFCAB3 ENSG00000172421.3 60447579 0.98 1.0 1617 16127
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr17:60445147-60445962]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results