Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 74521805 74525955 enh81278
chr17 74525744 74526079 vista26044

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 74525940 rs115289005 C T 5064220
chr17 74525989 rs537809198 G A 5064221
chr17 74526020 rs75351718 C T 5064222
chr17 74526048 rs538927922 G T 5064223
chr17 74526049 rs142800529 G A 5064224
chr17 74526183 rs551261639 TGGGAATGTTTCTCTACCAC T 5064225

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results