Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 74525744 74526079 vista26044
chr17 74526422 74526750 vista26045

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 74526020 rs75351718 C T 5064222
chr17 74526048 rs538927922 G T 5064223
chr17 74526049 rs142800529 G A 5064224
chr17 74526183 rs551261639 TGGGAATGTTTCTCTACCAC T 5064225
chr17 74526263 rs116707366 G A 5064226
chr17 74526356 rs147417122 C T 5064227
chr17 74526400 rs572540249 C A,T 5064228
chr17 74526422 rs114517086 C T 5064229
chr17 74526429 rs191363547 C G,T 5064230
chr17 74526465 rs140766782 C G 5064231
chr17 74526517 rs138591504 TGCGTGTGA T 5064232

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results