Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 74525744 74526079 vista26044

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 74526183 rs551261639 TGGGAATGTTTCTCTACCAC T 5064225
chr17 74526263 rs116707366 G A 5064226
chr17 74526356 rs147417122 C T 5064227
chr17 74526400 rs572540249 C A,T 5064228

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results