EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:74526069-74526409]
Chromosome characteristics of ZNF274[chr17:74526069-74526409]
Back to top
Enhancers possibly regulated by ZNF274[chr17:74526069-74526409]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 74525744 74526079 vista26044
VISTA
SNP sites on ZNF274[chr17:74526069-74526409]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 74526183 rs551261639 TGGGAATGTTTCTCTACCAC T 5064225
chr17 74526263 rs116707366 G A 5064226
chr17 74526356 rs147417122 C T 5064227
chr17 74526400 rs572540249 C A,T 5064228
Genes possibly regulated by ZNF274[chr17:74526069-74526409]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:74526069-74526409]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results