Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 75086431 75086552 vista26069

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75086537 rs140312678 G C 5069700
chr17 75086587 rs569954159 TA T 5069701
chr17 75086648 rs149316543 C T 5069702
chr17 75086751 rs144612707 A G 5069703
chr17 75086841 rs74875471 G A 5069704
chr17 75086949 rs9913954 G A 5069705
chr17 75086953 rs116328275 C T 5069706
chr17 75086967 rs534819377 GGCTGAGGTGGGGGGCTTAAAGCTGCAGTGAGTCATGATGGTGCCACTGCA G 5069707
chr17 75087093 rs142638326 G A 5069708
chr17 75087110 rs73376313 A T 5069709
chr17 75087234 rs569332151 A T 5069710

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 75085551 75085572 + hsa-miR-6516-3p MIMAT0030418 75084834 0.785537 0.0 1608 751