EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:75955229-75955953]
Chromosome characteristics of ZNF274[chr17:75955229-75955953]
Back to top
Enhancers possibly regulated by ZNF274[chr17:75955229-75955953]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 75955923 75956319 vista26158
VISTA
SNP sites on ZNF274[chr17:75955229-75955953]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75955264 rs920714 C T 5081868
chr17 75955276 rs541690919 C G 5081869
chr17 75955280 rs561625644 C T 5081870
chr17 75955406 rs530733482 C T 5081871
chr17 75955720 rs557904600 TGTTTTGGTGCAGGAGCCCG T 5081872
chr17 75955786 rs537758593 G T 5081873
chr17 75955807 rs114493241 C A 5081874
chr17 75955838 rs188339218 C G 5081875
chr17 75955907 rs142960888 C G 5081876
Genes possibly regulated by ZNF274[chr17:75955229-75955953]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:75955229-75955953]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results