Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 75955923 75956319 vista26158

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75955720 rs557904600 TGTTTTGGTGCAGGAGCCCG T 5081872
chr17 75955786 rs537758593 G T 5081873
chr17 75955807 rs114493241 C A 5081874
chr17 75955838 rs188339218 C G 5081875
chr17 75955907 rs142960888 C G 5081876
chr17 75955968 rs546313681 C G 5081877
chr17 75955980 rs544783479 G A 5081878
chr17 75956003 rs147119048 G T 5081879

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results