Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 78556082 78562855 enh32374
chr17 78560725 78560872 vista26333

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 78560637 rs117279226 C T 5103044
chr17 78560663 rs61527629 GTGTGATAGC G 5103045
chr17 78560663 rs67442237 GTGTGATAGC G 5103046
chr17 78560697 rs148878214 T C 5103047
chr17 78560922 rs549633788 ACCGGCCCGGCGCAGCCCCGCTCGCC A 5103048
chr17 78561115 rs145276067 G T 5103049
chr17 78561169 rs563902733 T C 5103050
chr17 78561355 rs568153475 T G 5103051
chr17 78561412 rs115925279 C T 5103052
chr17 78561516 rs147645884 T C 5103053

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results