Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 80290802 80291044 vista26460

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 80291051 rs113575046 T C 5121047
chr17 80291096 rs114048917 C T 5121048
chr17 80291475 rs59734194 G A 5121049
chr17 80291480 rs4789764 T C 5121050
chr17 80291517 rs532283923 AGTCCCCAGCACCGAGCCCGCCCCTCTGGTTCCCCC A 5121051
chr17 80291531 rs199885010 AGCCCGCCCCTCTGGTTCCCCC A 5121052

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 80278900 80291950 - SECTM1 ENSG00000141574.3 80291950 0.88 0.99 374 16392


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results