EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr17:80889041-80889671]
Chromosome characteristics of ZZZ3[chr17:80889041-80889671]
Back to top
Enhancers possibly regulated by ZZZ3[chr17:80889041-80889671]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 80889616 80889925 vista26497
VISTA
SNP sites on ZZZ3[chr17:80889041-80889671]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 80889088 rs3785515 C T 5126239
chr17 80889090 rs574869484 C T 5126240
chr17 80889207 rs140588182 C T 5126241
chr17 80889287 rs7208520 C T 5126242
chr17 80889380 rs575278505 GTCGCTCATTCCGCCTTGCCGT G 5126243
chr17 80889392 rs142865276 G A,T 5126244
chr17 80889395 rs555550567 T G 5126245
chr17 80889401 rs115547496 T G 5126246
chr17 80889500 rs183813971 G A 5126247
Genes possibly regulated by ZZZ3[chr17:80889041-80889671]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr17:80889041-80889671]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results