Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 56190905 56196315 enh17745
chr18 56194097 56194141 vista27606

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 56194125 rs192887833 A G 5285470
chr18 56194203 rs537440600 A G 5285471
chr18 56194314 rs529316078 C CTATCTAAATCTTCATTCCTCAAATTGATGGACTATCAAACCTTCAT 5285472
chr18 56194339 rs145159336 T C 5285473

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results