Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 76740873 76741825 vista28025

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 76740496 rs143266549 C T 5355198
chr18 76740515 rs4567806 C A 5355199
chr18 76740548 rs200575869 CGA C 5355200
chr18 76740584 rs556941405 C T 5355201
chr18 76740606 rs140107492 G A 5355202
chr18 76740727 rs575162746 G GGCCTCGGCGACCCCGGGGCGAGC,GGCGCCCCGGGGGCGAGC 5355203
chr18 76740732 rs183546197 C T 5355204
chr18 76740786 rs188276392 G T 5355205

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr18 76740275 76762677 + SALL3 ENSG00000256463.4 76740275 1.0 1.0 36 16682


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results