Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 750220 755228 enh44618
chr19 751766 752111 vista28103

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 751112 rs531490081 C G 5367065
chr19 751163 rs553663206 AGCCGGCAGGTGAGGCTGGGGGC A 5367066
chr19 751195 rs117425168 C T 5367067
chr19 751243 rs150790193 TG T 5367068
chr19 751243 rs746095216 TG T 5367069
chr19 751321 rs140974529 C T 5367070
chr19 751387 rs183445695 G A 5367071
chr19 751432 rs574164705 C T 5367072
chr19 751479 rs112456220 G A 5367073
chr19 751536 rs533319247 C T 5367074
chr19 751553 rs13345388 A G 5367075
chr19 751556 rs545298774 C T 5367076
chr19 751658 rs56002617 C G,T 5367077
chr19 751687 rs188497179 G C 5367078
chr19 751872 rs560279696 C T 5367079
chr19 751899 rs111572571 A AG 5367080
chr19 751982 rs545354872 C T 5367081
chr19 752165 rs112728286 C G,T 5367082

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 751126 764319 + MISP ENSG00000099812.6 751126 0.95 1.0 24 16715


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results