Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 4636294 4636441 vista28362

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 4636040 rs555992809 C T 5402081
chr19 4636065 rs563910031 C A 5402082
chr19 4636075 rs111472326 GATCCCATCACCCCATAAACGGA G 5402083
chr19 4636075 rs370449338 GATCCCATCACCCCATAAACGGA G 5402084
chr19 4636098 rs12980361 A G 5402085
chr19 4636164 rs77674545 C G 5402086
chr19 4636180 rs188497100 C T 5402087
chr19 4636197 rs371047180 T C 5402088
chr19 4636365 rs138591932 C T 5402089
chr19 4636490 rs144082255 G A 5402090
chr19 4636496 rs117882665 C T 5402091
chr19 4636544 rs111692270 T C 5402092

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 4639530 4655580 + TNFAIP8L1 ENSG00000185361.4 4639530 0.73 1.0 2847 16849


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results