EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:5826129-5829278]
Chromosome characteristics of ZNF274[chr19:5826129-5829278]
Back to top
Enhancers possibly regulated by ZNF274[chr19:5826129-5829278]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5829202 5829624 vista28400
VISTA
SNP sites on ZNF274[chr19:5826129-5829278]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5826145 rs368989978 CA C 5411028
chr19 5826145 rs538610154 CAA C 5411029
chr19 5826145 rs554746847 CA C 5411030
chr19 5826207 rs1678852 T C 5411031
chr19 5826239 rs531266260 G A 5411032
chr19 5826438 rs377397695 T C 5411033
chr19 5826454 rs539111910 G C 5411034
chr19 5826538 rs558560637 A G 5411035
chr19 5827097 rs1379868 A G 5411036
chr19 5827155 rs76829319 G A 5411037
chr19 5827207 rs546726197 G A 5411038
chr19 5827222 rs528214779 G T 5411039
chr19 5827322 rs571586563 C T 5411040
chr19 5827325 rs74501640 G A 5411041
chr19 5827405 rs189158813 G A 5411042
chr19 5827526 rs77571584 G A 5411043
chr19 5827614 rs367638230 T C 5411044
chr19 5827620 rs8106995 C T 5411045
chr19 5827638 rs1622498 A T 5411046
chr19 5827765 rs79744308 G A 5411047
chr19 5827770 rs143772327 C G 5411048
chr19 5827779 rs151082251 G C 5411049
chr19 5827826 rs200144113 G A,T 5411050
chr19 5828125 rs376877016 G T 5411051
chr19 5828150 rs560593242 A C 5411052
chr19 5828231 rs76231074 G A 5411053
chr19 5828237 rs569014843 A G 5411054
chr19 5828247 rs145045601 C T 5411055
chr19 5828293 rs116386264 G C 5411056
chr19 5828337 rs115043339 C T 5411057
chr19 5828368 rs188905550 C T 5411058
chr19 5828379 rs138838536 C T 5411059
chr19 5828380 rs1531616 A G 5411060
chr19 5828416 rs114355552 G C,T 5411061
chr19 5828451 rs181285369 G C 5411062
chr19 5828454 rs185069938 T C 5411063
chr19 5828629 rs181029814 G T 5411064
chr19 5828776 rs10775589 G C 5411065
chr19 5828811 rs112836591 TG T 5411066
chr19 5828892 rs113189876 G C 5411067
chr19 5828895 rs778811 G T 5411068
chr19 5828910 rs10853991 A G 5411069
chr19 5828921 rs778810 A G 5411070
chr19 5828939 rs148112183 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411071
chr19 5828939 rs377114531 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411072
chr19 5828939 rs752334055 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411073
chr19 5828939 rs755753379 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411074
chr19 5829182 rs8100656 A C 5411075
Genes possibly regulated by ZNF274[chr19:5826129-5829278]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:5826129-5829278]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results