EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:5827838-5829648]
Chromosome characteristics of ZNF274[chr19:5827838-5829648]
Back to top
Enhancers possibly regulated by ZNF274[chr19:5827838-5829648]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5829202 5829624 vista28400
VISTA
SNP sites on ZNF274[chr19:5827838-5829648]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5828125 rs376877016 G T 5411051
chr19 5828150 rs560593242 A C 5411052
chr19 5828231 rs76231074 G A 5411053
chr19 5828237 rs569014843 A G 5411054
chr19 5828247 rs145045601 C T 5411055
chr19 5828293 rs116386264 G C 5411056
chr19 5828337 rs115043339 C T 5411057
chr19 5828368 rs188905550 C T 5411058
chr19 5828379 rs138838536 C T 5411059
chr19 5828380 rs1531616 A G 5411060
chr19 5828416 rs114355552 G C,T 5411061
chr19 5828451 rs181285369 G C 5411062
chr19 5828454 rs185069938 T C 5411063
chr19 5828629 rs181029814 G T 5411064
chr19 5828776 rs10775589 G C 5411065
chr19 5828811 rs112836591 TG T 5411066
chr19 5828892 rs113189876 G C 5411067
chr19 5828895 rs778811 G T 5411068
chr19 5828910 rs10853991 A G 5411069
chr19 5828921 rs778810 A G 5411070
chr19 5828939 rs148112183 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411071
chr19 5828939 rs377114531 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411072
chr19 5828939 rs752334055 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411073
chr19 5828939 rs755753379 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411074
chr19 5829182 rs8100656 A C 5411075
chr19 5829349 rs141960626 T C 5411076
chr19 5829352 rs552518870 A C 5411077
chr19 5829592 rs11666494 A G 5411078
chr19 5829599 rs533643032 C T 5411079
Genes possibly regulated by ZNF274[chr19:5827838-5829648]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:5827838-5829648]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results