Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 10215397 10215725 vista28563
chr19 10215832 10216068 vista28564

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 10215451 rs77442942 C T 5434685
chr19 10215584 rs184068397 G A 5434686
chr19 10215586 rs755258 C T 5434687
chr19 10215701 rs554300917 CCACAGAGCCCAGGCCCAGG C 5434688
chr19 10215751 rs140808530 G A 5434689
chr19 10215810 rs113815507 C T 5434690
chr19 10215941 rs144574044 C G 5434691
chr19 10215957 rs372356922 T A 5434692
chr19 10215983 rs77601122 A C,G 5434693
chr19 10216030 rs112652849 A C 5434694
chr19 10216064 rs564033973 A G 5434695
chr19 10216187 rs3760755 G A 5434696
chr19 10216278 rs78161520 CA C 5434697
chr19 10216332 rs182516587 G C 5434698
chr19 10216480 rs566548196 A G 5434699
chr19 10216604 rs3760756 A G 5434700
chr19 10216684 rs556452543 C A,T 5434701
chr19 10216772 rs76874150 G T 5434702
chr19 10216835 rs73009299 G T 5434703
chr19 10216915 rs141612097 C T 5434704
chr19 10216971 rs2290685 C T 5434705
chr19 10216977 rs2290686 T A 5434706
chr19 10217099 rs145490435 G A 5434707
chr19 10217248 rs11559190 C T 5434708
chr19 10217338 rs11559189 C T 5434709
chr19 10217380 rs61064209 A C 5434710
chr19 10217441 rs3841592 TA T 5434711

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 10216899 10225456 + PPAN-P2RY11 ENSG00000243207.2 10216899 0.87 0.85 560 16993
chr19 10216965 10225414 + PPAN ENSG00000130810.15 10216965 0.83 0.91 494 16994
chr19 10222214 10226048 + P2RY11 ENSG00000244165.1 10222214 0.68 1.0 4755 16995


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results