Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 10215397 10215725 vista28563

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 10215451 rs77442942 C T 5434685
chr19 10215584 rs184068397 G A 5434686
chr19 10215586 rs755258 C T 5434687
chr19 10215701 rs554300917 CCACAGAGCCCAGGCCCAGG C 5434688

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 10216899 10225456 + PPAN-P2RY11 ENSG00000243207.2 10216899 0.87 0.85 1177 16993
chr19 10216965 10225414 + PPAN ENSG00000130810.15 10216965 0.83 0.91 1243 16994


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results