EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:11878581-11878981]
Chromosome characteristics of ZNF274[chr19:11878581-11878981]
Back to top
Enhancers possibly regulated by ZNF274[chr19:11878581-11878981]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 11878639 11879058 vista28638
VISTA
SNP sites on ZNF274[chr19:11878581-11878981]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 11878582 rs73922688 T C 5444248
chr19 11878779 rs114579730 G A 5444249
chr19 11878960 rs576148168 TCCTAACTCCTCCTAGGGCCGA T 5444250
Genes possibly regulated by ZNF274[chr19:11878581-11878981]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 11877815 11894893 + ZNF441 ENSG00000197044.6 11877815 0.73 0.94 766 17053
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr19:11878581-11878981]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results