Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 11878639 11879058 vista28638

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 11878779 rs114579730 G A 5444249
chr19 11878960 rs576148168 TCCTAACTCCTCCTAGGGCCGA T 5444250

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 11877815 11894893 + ZNF441 ENSG00000197044.6 11877815 0.73 0.94 774 17053


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results