Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 12994554 12994766 vista28663

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 12994316 rs111933865 GATTTCGAAACCAGCCTGGCCAGC G 5447155
chr19 12994321 rs567222876 C T 5447156
chr19 12994335 rs537835324 C T 5447157
chr19 12994339 rs549789648 C G 5447158
chr19 12994353 rs74726681 A G 5447159
chr19 12994450 rs145434528 G C 5447160
chr19 12994618 rs80326512 C T 5447161
chr19 12994687 rs145205186 A T 5447162
chr19 12994715 rs2280742 A G 5447163

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 12995237 12997995 - KLF1 ENSG00000105610.4 12997995 0.9 1.0 3268 17103


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results