EnhancerDB
  1. Home
  2. TFBS
  3. CEBPB[chr2:121523571-121523747]
Chromosome characteristics of CEBPB[chr2:121523571-121523747]
Back to top
Enhancers possibly regulated by CEBPB[chr2:121523571-121523747]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 121504894 121548419 enh18846
Liver Astrocyte Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Kidney Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Neural Stem Cells (H9) Prostate (PC-3) Large Intestine Esophagus Placenta Muscle (Myoblast) Spleen Muscle (Myotube) Lung Muscle (A673) Heart
chr2 121523492 121523901 vista32941
VISTA
SNP sites on CEBPB[chr2:121523571-121523747]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 121523586 rs531383876 CTCTGTGGGCAAGGTCTCGGAGACG C 5994234
chr2 121523653 rs80101048 T C 5994235
Genes possibly regulated by CEBPB[chr2:121523571-121523747]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by CEBPB[chr2:121523571-121523747]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results