Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 121504894 121548419 enh18846
chr2 121523492 121523901 vista32941

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 121523586 rs531383876 CTCTGTGGGCAAGGTCTCGGAGACG C 5994234
chr2 121523653 rs80101048 T C 5994235

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results