Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 18400891 18401631 vista51222

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 18401368 rs560439197 T TTTAATTAAATTAAATTAAAATTGAA 8883045
chr6 18401373 rs569755351 A T 8883046
chr6 18401374 rs536715338 A T 8883047
chr6 18401380 rs567329554 C A 8883048
chr6 18401381 rs6907980 A G 8883049
chr6 18401424 rs138863472 C T 8883050
chr6 18401447 rs193251308 A G 8883051
chr6 18401461 rs72832426 A G 8883052

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results