Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 30644713 30652115 enh93488
chr6 30649746 30650798 vista51524
chr6 30651242 30651620 vista51525

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 30649912 rs2239888 T C 8947958
chr6 30649931 rs2239887 C G 8947959
chr6 30649932 rs371569541 C A,G 8947960
chr6 30650006 rs574523760 T TG 8947961
chr6 30650007 rs182182546 G C,T 8947962
chr6 30650026 rs9262142 G A 8947963
chr6 30650318 rs2394392 T G 8947964
chr6 30650456 rs117116128 A G 8947965
chr6 30650479 rs566985664 C T 8947966
chr6 30650546 rs113149477 C G 8947967
chr6 30650596 rs199834657 T TTGCTTCCTGGCTCCCCTGGGA 8947968
chr6 30650664 rs187856987 A C 8947969
chr6 30650758 rs143719639 T G 8947970
chr6 30650860 rs117580792 G T 8947971
chr6 30650905 rs148103483 G A,C 8947972

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr6 30644166 30655672 - PPP1R18 ENSG00000146112.7 30655672 0.75 0.78 4338 6347


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results