Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 30644713 30652115 enh93488
chr6 30649746 30650798 vista51524

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 30650318 rs2394392 T G 8947964
chr6 30650456 rs117116128 A G 8947965
chr6 30650479 rs566985664 C T 8947966
chr6 30650546 rs113149477 C G 8947967
chr6 30650596 rs199834657 T TTGCTTCCTGGCTCCCCTGGGA 8947968
chr6 30650664 rs187856987 A C 8947969

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr6 30644166 30655672 - PPP1R18 ENSG00000146112.7 30655672 0.75 0.78 4953 6347


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results