Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 35491656 35492052 vista61855
chr9 35492185 35492605 vista61856

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 35491429 rs560474047 T C 11003750
chr9 35491448 rs145849575 C T 11003751
chr9 35491466 rs34167533 C T 11003752
chr9 35491539 rs73496830 T G 11003753
chr9 35491667 rs573068352 G A 11003754
chr9 35491824 rs542631147 TAGTCCCAGCAACTCAGGAGGCTGA T 11003755
chr9 35491848 rs543859874 A T 11003756
chr9 35491883 rs7846774 C T 11003757
chr9 35491954 rs191221781 A C 11003758
chr9 35491971 rs72725048 A G 11003759
chr9 35492158 rs370985272 C G 11003760
chr9 35492420 rs114715689 G C 11003761
chr9 35492466 rs72725049 A G 11003762

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results