Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 35603992 35604628 vista61861

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 35603960 rs558537270 A ACTCAGCCTCGCTTCCTCGAGGAGCT 11004156
chr9 35604045 rs2297876 G A 11004157
chr9 35604099 rs184647717 A C,G 11004158
chr9 35604128 rs2297877 C G 11004159
chr9 35604150 rs77724180 G C 11004160
chr9 35604166 rs148671143 G A 11004161

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr9 35605367 35610038 + TESK1 ENSG00000107140.11 35605367 0.62 1.0 926 8928


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr9 35608136 35608156 + hsa-miR-4667-3p MIMAT0019744 35605258 0.865074 0.0 817 1576