Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 1101625 1106695 enh32397

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 1103210 rs536366928 GGACCTTGAAAGGTGACTTGTAGAT G 5135114

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results