| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr18 | 77498711 | 77502763 | enh102588 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr18 | 77502081 | rs561234908 | AGAGGCCTGGGGGCAGCAGAGGAGGCATGAGGTG | A | 5360404 | |
| chr18 | 77502081 | rs61531050 | AGAGGCCTGGGGGCAGCAGAGGAGGCATGAGGTG | A | 5360405 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|