Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 77498711 77502763 enh102588

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 77502081 rs561234908 AGAGGCCTGGGGGCAGCAGAGGAGGCATGAGGTG A 5360404
chr18 77502081 rs61531050 AGAGGCCTGGGGGCAGCAGAGGAGGCATGAGGTG A 5360405

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results