Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 750220 755228 enh44618

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 754825 rs556474625 G A 5367142
chr19 754826 rs562906232 AGGTTTGGGGTGGAGGAAGAGGGCCT A 5367143

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results