Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 68409705 68420455 enh4106

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 68414449 rs368672251 TCACCTGCTCCCGGCTGACCAGCGC T 4500229
chr16 68414449 rs370633737 TCACCTGCTCCCGGCTGACCAGCGC T 4500230

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results