EnhancerDB
  1. Home
  2. TFBS
  3. SPI1[chr19:1307567-1307573]
Chromosome characteristics of SPI1[chr19:1307567-1307573]
Back to top
Enhancers possibly regulated by SPI1[chr19:1307567-1307573]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1302385 1328100 enh32871
Bone Marrow (K562) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Colon (HCT116) Lung (PC-9) Pancreas
SNP sites on SPI1[chr19:1307567-1307573]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1307570 rs5741781 T TCAG,TCCGCCACAGGCCCGGGTTCAG 5374531
Genes possibly regulated by SPI1[chr19:1307567-1307573]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SPI1[chr19:1307567-1307573]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results