Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1302385 1328100 enh32871

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1322929 rs552616013 AGGAGACAGAGAAAGAGACAGAGAGACAGAG A 5374834
chr19 1322935 rs202022940 CAG C 5374835
chr19 1322935 rs3068966 CAG C 5374836
chr19 1322947 rs578164709 CAGAG C 5374837

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results