Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1392545 1396695 enh76095

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1394660 rs200980086 CCTCCCTCCCTGCGGACTGTGCTG C 5375221
chr19 1394670 rs543408286 T A 5375222

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results