Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1584877 1591715 enh17843

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1591445 rs549639731 G GGAGCGGTCGTTCTGCCCCTCCTT 5376723

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 1576639 1592882 - MBD3 ENSG00000071655.13 1592882 0.54 0.99 1428 16756


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results