Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 3186541 3192308 enh52835

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 3190729 rs148109836 C T 5392384
chr19 3190731 rs188123064 C A,T 5392385
chr19 3190732 rs373278029 CCCCGGCCCCCCTGCGTCAGGCCTGTA C 5392386
chr19 3190732 rs553049022 CCCCGGCCCCCCTGCGTCAGGCCTGTA C 5392387

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results