Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 3558330 3566135 enh17866

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 3561958 rs530472694 CTTTTCTTGTTTTTTTTGAGATGGAG C 5395664

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results