Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 4870509 4882730 enh48155

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 4874496 rs562692797 A AACAGTACAGAAGGACGTTCCAGTC 5404434

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results