Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5162945 5179095 enh17878

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5165654 rs376601056 CTGCTGATTGGTCCATTTTACAGAG C 5407575
chr19 5165654 rs569918458 CTGCTGATTGGTCCATTTTACAGAG C 5407576

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results