Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5605405 5609555 enh81484

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5606036 rs556779579 AAGGAGCAGAGGGAACAATC A 5410142
chr19 5606036 rs575980917 AAGGAGCAGAGGGAACAATC A 5410143

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results