Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5890213 5894363 enh65169

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5891771 rs543697949 AGCCTCTTCATCCTTGGGCCCTCTCTGCTGTGCC A 5411336

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results