Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 6526925 6534410 enh4985

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 6530934 rs546156218 AAGGGGCGTGGCCGCGGGCGG A 5414880

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 6531010 6535931 + TNFSF9 ENSG00000125657.3 6531010 0.91 1.0 75 16893


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results