Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 7835665 7840935 enh96825

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 7837112 rs372259996 G GAATAGATTTTCCACCTATT 5424372

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results